| CARD ID | 1175 | |
| Type of strain | Targeted mutant. | |
| Strain name | C.129-Mta2tm1 | |
| Internal Code | - | |
| Submitter | Okamura Takeshi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | National Kyushu Cancer Center |
| Organization code | ||
| Developer | Soichi Takiguchi | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mta2 |
| Gene name | Metastasis-associated gene 2 |
| Allele symbol | Mta2 |
| Allele name | targeted mutation 1 |
| MGI | MGI:1346340, |
| Chromosome | 19 (B) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Mtal/2ml | TAGCTTTACGGAGCCCTGGCGCTCG |
| Mta2-com | CAGGAAGCACAAAGTCGGCACTGC |
| Disease name, Applicable field | Unknown |