| CARD ID | 1126 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6.129-Cthtm1 | |
| Internal Code | Cth-Knockout | |
| Submitter | ISHII ISAO | |
| Submitter affiliation or code | Showa Pharmaceutical University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Showa Pharmaceutical University |
| Organization code | 不明 | |
| Developer | Isao Ishii | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cth |
| Gene name | cystathionase (cystathionine gamma-lyase) |
| Allele symbol | Cthtm1 |
| Allele name | cystathionase (cystathionine gamma-lyase); targeted mutation |
| MGI | MGI:1339968, |
| Chromosome | 3 (3H4) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| Cth-1(CSE-F2) | TGCCGACCAATAAGCAGGGC |
| Cth-2(CSE-PCR-1) | AAAATCACGTTGTTGGTCAA |
| Author | Yamada H, Akahoshi N, Kamata S, Hagiya Y, Hishiki T, Nagahata Y, et al. |
| Title | Methionine excess in diet induces acute lethal hepatitis in mice lacking cystathionine gamma-lyase, an animal model of cystathioninuria. |
| Journal | Free Radic Biol Med |
| Volume | 52 |
| Page | 1716-1726 |
| Year | 2012 |
| PMID |
| Author | Akahoshi N, Kamata S, Kubota M, Hishiki T, Nagahata Y, Matsuura T, et al. |
| Title | Neutral aminoaciduria in cystathionine beta-synthase-deficient mice, an animal model of homocystinuria. |
| Journal | Am J Physiol Renal Physiol |
| Volume | 306 |
| Page | F1462-F1476 |
| Year | 2014 |
| PMID |
| Author | Hagiya Y, Kamata S, Mitsuoka S, Okada N, Yoshida S, Yamamoto J, et al. |
| Title | Hemizygosity of transsulfuration genes confers increased vulnerability against acetaminophen-induced hepatotoxicity in mice. |
| Journal | Toxicol Appl Pharmacol |
| Volume | 282 |
| Page | 195-206 |
| Year | 2015 |
| PMID |
| Author | Nakano S, Ishii I, Shinmura K, Tamaki K, Hishiki T, Akahoshi N, et al. |
| Title | Hyperhomocysteinemia abrogates fasting-induced cardioprotection against ischemia/reperfusion by limiting bioavailability of hydrogen sulfide anions. |
| Journal | J Mol Med |
| Volume | 93 |
| Page | 879-889 |
| Year | 2015 |
| PMID |
| Author | Szijarto IA, Marko L, Filipovic MR, Miljkovic JL, Tabeling C, Tsvetkov D, et al. |
| Title | Cystathionine gamma-lyase-produced hydrogen sulfide controls endothelial NO bioavailability and blood pressure. |
| Journal | Hypertension |
| Volume | 71 |
| Page | 1210-1217 |
| Year | 2018 |
| PMID |
| Author | Isao Ishii, Noriyuki Akahoshi, Hidenori Yamada, Shintaro Nakano, Takashi Izumi, and Makoto Suematsu |
| Title | Cystathionine gamma-Lyase-deficient Mice Require Dietary Cysteine to Protect against Acute Lethal Myopathy and Oxidative Injury |
| Journal | J. Biol. Chem. |
| Volume | 285 |
| Page | 26358-26368 |
| Year | 2010 |
| PMID |
| Disease name, Applicable field | Physiology, Development, Metabolism |