| CARD ID | 1073 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6.129-S1pr2tm1Jch | |
| Internal Code | SIP2-Knockout | |
| Submitter | ISHII ISAO | |
| Submitter affiliation or code | Showa Pharmaceutical University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | Showa Pharmaceutical University |
| Organization code | ||
| Developer | Isao Ishii | |
| Origin (From other organizations) | Organization | The Scripps Research Institute |
| Organization code | Jch | |
| Developer | Dr. Jerold Chun | |
| Year introduced | 2005 / 4 | |
| Introduced Generation | N5+F? | |
| Remarks | ||
| Gene symbol | S1pr2 (Synonym: Edg5) |
| Gene name | Endothelial differentiation, sphingolipid G-protein-coupled receptor,5 |
| Allele symbol | S1pr2tm1Jch |
| Allele name | targeted mutation 1, Jerold Chun |
| MGI | |
| Chromosome | 9 (6.0) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| Edg5-1(B2-neo) | GCTAAAGCGCATGCTCCAGACT |
| Edg5-2(B2-SA) | ACACCCTTTGTATCAAGTGGCAA |
| Author | Imasawa T, Koike K, Ishii I, Chun J, Yatomi Y. |
| Title | Blockade of sphingosine 1-phosphate receptor 2 signaling attenuates streptozotocin-induced apoptosis of pancreatic beta-cells. |
| Journal | Biochem Biophys Res Commun |
| Volume | 392 |
| Page | 207-211 |
| Year | 2010 |
| PMID |
| Author | Akahoshi N, Ishizaki Y, Yasuda H, Murashima YL, Shinba T, Goto K, et al. |
| Title | Frequent spontaneous seizures followed by spatial working memory/anxiety deficits in mice lacking sphingosine 1-phosphate receptor 2. |
| Journal | Epilepsy Behav |
| Volume | 22 |
| Page | 659-665 |
| Year | 2011 |
| PMID |
| Author | Kitada Y, Kajita K, Taguchi K, Mori I, Yamauchi M, Ikeda T, et al. |
| Title | Blockade of sphingosine 1-phosphate receptor 2 signaling attenuates high-fat diet-induced adipocyte hypertrophy and systemic glucose intolerance in mice. |
| Journal | Endocrinology |
| Volume | 157 |
| Page | 1839-1851 |
| Year | 2016 |
| PMID |
| Author | Isao Ishii, Xiaoqin Ye, Beth Friedman, Shuji Kawamura, James J. A. Contos, Marcy A. Kingsbury, Amy H. Yang, Guangfa Zhang, Joan Heller Brown, and Jerold Chun |
| Title | Marked Perinatal Lethality and Cellular Signaling Deficits in Mice Null for the Two Sphingosine 1-Phosphate (S1P) Receptors, S1P2/LPB2/EDG-5 and S1P3/LPB3/EDG-3 |
| Journal | J. Biol. Chem. |
| Volume | 277 |
| Page | 25152-25159 |
| Year | 2002 |
| PMID |
| Disease name, Applicable field | Physiology, Development, Immunology, Dermatology, Neurobiology, Metabolism |