| CARD ID | 1056 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6J-Tg(Irs1-IRS1) | |
| Internal Code | IRS-1-Tg | |
| Submitter | Unknown Unknown | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Metabolic Medicine, Kumamoto University |
| Organization code | ||
| Developer | Eiichi Araki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | IRS1 |
| Gene name | Insulin receptor substrate-1 |
| Allele symbol | Tg(Irs1-IRS1) |
| Allele name | transgene insertion |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| IRS1-h5 | TTTCTCCTCAACACCCAGTGCCA |
| IRS1-h3 | TGCACTCCTGAGGGCACTGTTTGAAGT |
| Disease name, Applicable field | Metabolism |