| CARD ID | 787 | |
| Type of strain | Transgenic. | |
| Strain name | Tg(PrP delta preOR) | |
| Internal Code | Tg(PrP delta preOR) | |
| Submitter | YOSHIKAWA DAISUKE | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | ||
| Origin (In-house) | Organization | Departmennto of Molecular Microbiology and Immunology |
| Organization code | Ngs | |
| Developer | Daisuke Yoshikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Prnp &Delta preOR |
| Gene name | Prnp &Delta preOR |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| SHa-forward | gcgtgctggacaatgacgtg |
| del-reverse | ggttggtttttggtttgctg |
| Disease name, Applicable field | Unknown |