| CARD ID | 510 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Sall4tm1(Neo)#14 | |
| Internal Code | N-Sall4+Neo #14 | |
| Submitter | Nishinakamura Ryuichi | |
| Submitter affiliation or code | Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | University of Tokyo. Institute of Medical Sciences, |
| Organization code | ||
| Developer | Masayo Yumoto | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Sall4 |
| Gene name | sal-like4 (Drosophila) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:2139360, |
| Chromosome | 2 (99.0) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| N-Sall4 + Neo genome check (Sall4 N F, Sall4 N R, Sall4 N Neo); mixture of 25 micro M each | CCTTCACCTTGAAGCCTGAC, GGGACAGGGAGTGCATAGTG, GGGGAACTTCCTGACTAGGG |
| |
| Disease name, Applicable field | Development |