| CARD ID | 2991 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6J-Wnt2bem1(Cre/ERT2) | |
| Internal Code | Wnt2b-2A-CreERT2 (No.2) | |
| Submitter | Takahashi Masanori | |
| Submitter affiliation or code | Center for Molecular Medicine, Jichi Medical University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Jichi Medical University |
| Organization code | ||
| Developer | Masanori Takahashi | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Wnt2b |
| Gene name | wingless-type MMTV integration site family, member 2B |
| Allele symbol | Wnt2bem1(Cre/ERT2) |
| Allele name | wingless-type MMTV integration site family, member 2B; endonuclease-mediated mutation 1, |
| MGI | MGI:1261834, |
| Chromosome | 3 (45.88) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| Wnt2b screening 5Fw (28 mer) | TTAATCTCAGTTTGGCCCCCATTGTACT |
| Cre Tm68 R2 (28 mer) | CTTTTGCAAGGAATGCGATGAAGTAGAG |
| Author | Masanori Takahashi , Takayuki Isagawa , Tatsuyuki Sato , Norihiko Takeda , Kiyoshi Kawakami |
| Title | Lineage tracing using Wnt2b-2A-CreERT2 knock-in mice reveals the contributions of Wnt2b-expressing cells to novel subpopulations of mesothelial/epicardial cell lineages during mouse development |
| Journal | Genes Cells |
| Volume | |
| Page | DOI: 10.1111/gtc.13147 |
| Year | 2024 |
| PMID | 39109760 |
| Disease name, Applicable field | Development |