CARD ID | 359 | |
Type of strain | Targeted mutant. | |
Strain name | B6;129-Adra1dtm1 | |
Internal Code | B6 α1D-AR-KO | |
Submitter | Nakamura Kazuaki | |
Submitter affiliation or code | National Research Institute for Child Health and Development | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | Tanoue Akito | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Adra1d |
Gene name | Adrenergic recetor, alpha 1d |
Allele symbol | Adra1dtm1 |
Allele name | Adrenergic recetor, alpha 1d, targeted mutation 1 |
MGI | MGI:106673, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
GO | Gene Ontology |
OMIM | OMIM ID: 104219 Human Gene Symbol: ADRA1D, |
primerA | 5'(ACACAGCTGCACTCAGTAGCAGGTCA)3' |
primerB | 5'(CCTAC,ATTTT,GAATG,GAAGG,ATTG)3' |
Author | Akito Tanoue, Yoshihisa Nasa, Takaaki Koshimizu, Hitomi Shinoura, Sayuri Oshikawa, Takayuki Kawai, Sachie Sunada, Satoshi Takeo, and Gozoh Tsujimoto |
Title | The α1D-adrenergic receptor directly regulates arterial blood pressure via vasoconstriction |
Journal | The Journal of Clinical Investigation |
Volume | 109 |
Page | 765-775 |
Year | 2002 |
PMID | 11901185 |
Disease name, Applicable field | Physiology |