CARD R-BASE



Mouse strain


Strain information

CARD ID 1884
Type of strain Targeted mutant.
Strain name B6;129-Spink3tm1(SPINK1) Card
Internal Code SPINK1 knockin mouse
Submitter Ken-ichi YAMAMURA
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Center for Animal Resources & Development (CARD), Kumamoto University
Organization code Card
Developer Ken-ichi Yamamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Spink 1
Gene name serine protease inhibitor Kazal type 1
Allele symbol
Allele name serine protease inhibitor Kazal type 1, targeted mutation 1, Naomi Nakagata, Center for Animal Resources and Development
MGI MGI:106202,
Chromosome 18 (23.47 ) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
SPINK1-1-1 gaaggtaacaggcatctttcttctc
SPINK1-1-2 atctctttacctctcttcccaggg


References

Author Wang J, Ohmuraya M, Hirota M, Baba H, Zhao G, Takeya M, Araki K, Yamamura K
Title Expression pattern of serine protease inhibitor kazal type 3 (Spink3) during mouse embryonic development.
Journal Histochem Cell Biol.
Volume 130
Page 387-97
Year 2008
PMID
Author Ohmuraya M, Hirota M, Araki M, Mizushima N,Matsui M, Mizumoto T, Haruna K, Kume S, Takeya M, Ogawa M, Araki K, Yamamura K.
Title Autophagic cell death of pancreatic acinar cells in serine protease inhibitor kazal type 3-deficient mice.
Journal Gastroenterology
Volume Aug;129(2)
Page 696-705
Year 2005
PMID 16083722


Disease , Applicable field information

Disease name, Applicable field Laboratory-animal Science






Copyright @ 2021 Kumamoto University. All rights reserved.