CARD ID | 739 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6-Tg(B19p6-NS1w)66aTusm | |
Internal Code | C57BL/6-Tg(B19p6NS1w)66aTusm | |
Submitter | Unknown Unknown | |
Submitter affiliation or code | ||
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Tohoku University |
Organization code | Tusm | |
Developer | Naruhiko Takasawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | NS1 |
Gene name | human parvovirus B19, NS1 |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
Im-1 | CGCCTGGAACACTGAAACCC |
Im-2 | AGCCTGCACCTGAGGAGTGA |
Author | Naruhiko Takasawa, Yasuhiko Munakata, Keiko Kumura Ishii, Yuichi Takahashi, Minako Takahashi, Yi Fu, Tomonori Ishii, Hiroshi Fujii, Takako Saito, Hiroshi Takano, Tetsuo Noda, Misao Suzuki, Masato Nose, Suzan Zolla-Patzner, and Takeshi Sasaki |
Title | Human Parvovirus B19 Transgenic Mice Become Susceptible to Polyarthritis |
Journal | The Journal of Immunology |
Volume | 173 |
Page | 4675-4683 |
Year | 2004 |
PMID |
Disease name, Applicable field | Immunology |