CARD ID | 1432 | |
Type of strain | Targeted mutant. | |
Strain name | B6.129-Atp1a2tm2Kwk | |
Internal Code | BL6N | |
Submitter | KAWAKAMI KIYOSHI | |
Submitter affiliation or code | jichi medical university | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Jichi Medical University |
Organization code | ||
Developer | Kiyoshi Kawakami | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Atp1a2 |
Gene name | ATPase, Na+/K+ transporting, alpha 2 polypeptide |
Allele symbol | Atp1a2tm2Kwk |
Allele name | ATPase, Na+/K+ transporting, alpha 2 polypeptide; targeted mutation 2, Kiyoshi Kawakami |
MGI | |
Chromosome | 1 (79.6) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
9538-N4 | GGGAGAGACAGACACGGAGGAAGATGAC |
9537-NeoR3 | gcctgcttgccgaatatcatggtggaaaat |
Disease name, Applicable field | Physiology, Anatomy, Dermatology, Neurobiology, Metabolism |