CARD R-BASE



Mouse strain


Strain information

CARD ID 1721
Type of strain Gene trap.
Strain name C57BL/6N-Col4a4Gt(LTOCG)17Osb
Internal Code LTOCG-17:Col4a4
Submitter kikutani hitoshi
Submitter affiliation or code Research Institute for Microbial Diseases
Stock Type
Material Transfer Conditions Others
The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES.
Production method in-house breeding
Origin (In-house) Organization Research Institute for Microbial Diseases, Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Col4a4
Gene name Collagen, type IV, alpha 4
Allele symbol
Allele name
MGI MGI:104687,
Chromosome 1 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Other
OMIM

PCR Primer 1
4135 gatctctagttaccagagtcac
ARC08-02-05 agtggcatgattctgtgcaaggt


Disease , Applicable field information

Disease name, Applicable field Unknown






Copyright @ 2021 Kumamoto University. All rights reserved.