CARD ID | 1838 | |
Type of strain | Targeted mutant. | |
Strain name | B6-Mir142tm1Card | |
Internal Code | 21-KBW111reKO17 | |
Submitter | Masatake ARAKI | |
Submitter affiliation or code | Gene Technology Center, IRDA, Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | Card | |
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Mir142 |
Gene name | microRNA 142 |
Allele symbol | |
Allele name | |
MGI | MGI:2676827, |
Chromosome | 11 (52.21) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Z-1 | GCGTTACCCAACTTAATCG |
Z-2 | TGTGAGCGAGTAACAACCCG |
Author | Tanaka, K., et al. |
Title | MiR-142 is required for Staphylococcus aureus clearance at skin wound sites via small GTPase-mediated regulation of the neutrophil actin cytoskeleton. |
Journal | J. Invest, Dermatol. |
Volume | 137 |
Page | 931-940 |
Year | 2017 |
PMID |
Disease name, Applicable field | Development, Immunology, Dermatology, Hematology |