CARD ID | 3307 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Sordem115 | |
Internal Code | Sord flox #15 | |
Submitter | Masayasu Kojima | |
Submitter affiliation or code | Kurume University Institute of Life Science | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Sord |
Gene name | Sorbitol dehydrogenase |
Allele symbol | Sordem115 |
Allele name | Sorbitol dehydrogenase; endonuclease-mediated mutation 1, |
MGI | MGI:98266, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
5'loxP_F2 | taaccctggccagttaacca |
5'loxP_R2 | aggagctcattgggaacaca |
3'loxP_F2 | aatcactgagtgcccagagtc |
3'loxP_R2 | gccctaccatgaaaaagtcg |
Disease name, Applicable field | Metabolism, Endocrine Disorders |