CARD ID | 1813 | |
Type of strain | Targeted mutant. | |
Strain name | B6;129-Mll1tm1.1Mlc | |
Internal Code | MlldC | |
Submitter | Yokoyama Akihiko | |
Submitter affiliation or code | Kyoto University Graduate School of Medicine Medical Innovation Center Laboratory for Malignancy Control Research DSK project | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | Stanford University Medical School |
Organization code | Mlc | |
Developer | Michael L. Cleary | |
Year introduced | 2009 / 5 | |
Introduced Generation | ||
Remarks |
Gene symbol | Mll1 |
Gene name | myeloid/lymphoid or mixed-lineage leukemia 1 |
Allele symbol | Mll1tm1.1Mlc |
Allele name | myeloid/lymphoid or mixed-lineage leukemia 1; targeted mutation 1.1, Michael L Cleary |
MGI | MGI:96995, |
Chromosome | 9 (24.84) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
dC&uc.fwd | gttctgaagcacacattccacacc |
dC&uc.rev | catcaaagcgaagggcaatcagtg |
Author | Yokoyama, A., Ficara, F., Murphy, M. J., Meisel, C., Naresh, A., Kitabayashi, I. and Cleary, M. L. |
Title | Proteolytically cleaved MLL subunits are susceptible to distinct degradation pathways. |
Journal | J Cell Sci |
Volume | 124 |
Page | 2208-2219 |
Year | 2011 |
PMID |
Disease name, Applicable field | Aging, Molecular biology, Cell biology, cancer, Endocrine Disorders, Hematology |