| CARD ID | 2890 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Tmem59ltm1Miya | |
| Internal Code | Tmem59l KO | |
| Submitter | Miyazaki Satsuki | |
| Submitter affiliation or code | Division of Stem Cell Regulation Research Osaka University Graduate School of Medicine | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | The Institute of Scientific and Industrial Research, Osaka University |
| Organization code | Miya | |
| Developer | Jun-ichi Miyazaki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Tmem59l |
| Gene name | transmembrane protein 59-like |
| Allele symbol | Tmem59ltm1Miya |
| Allele name | transmembrane protein 59-like; targeted mutation 1, |
| MGI | MGI:1915187, |
| Chromosome | 8 (34.15) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| T59l-GT-F1 | CGTATCTAGCCAGGTCCTCTTTGT |
| T59l-GT-R1 | CTTCTCAGAGAGAGGCAGAGCTTG |
| pgk-A5 | GTTGGCGCCTACCGGTGGATGTGGAATGTG |
| Author | Kobayashi M, Yamato E, Tanabe K, Tashiro F, Miyazaki S, Miyazaki J-i |
| Title | Functional Analysis of Novel Candidate Regulators of Insulin Secretion in the MIN6 Mouse Pancreatic beta Cell Line |
| Journal | PLoS ONE |
| Volume | 11 |
| Page | e0151927 |
| Year | 2016 |
| PMID |
| Disease name, Applicable field | Diabetes, Metabolism |