CARD ID | 3227 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6-Tg(SPC-EGFRdelta746-750)Takt | |
Internal Code | SPC-hEGFRdel746-750 | |
Submitter | Takashi Takahashi | |
Submitter affiliation or code | Aichi Cancer Center | |
Stock Type | ||
Material Transfer Conditions |
Others
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | Kenichi Yamamura |
Organization code | 不明 | |
Developer | Center for Animal Resources and Development, Kumamoto University | |
Year introduced | 2013 / 7 | |
Introduced Generation | ||
Remarks |
Gene symbol | EGFR |
Gene name | epidermal growth factor receptor |
Allele symbol | |
Allele name | |
MGI | MGI:, |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
EGFRΔ746-750-F | GCCAGGAACAAACAGGCTTC |
EGFRΔ746-750-R | CCAAAGGAATTCGCTCCACT |
Author | Isomura H, Taguchi A, Kajino T, Asai N, Nakatochi M, Kato S, Suzuki K,Yanagisawa K, Suzuki M, Fujishita T, Yamaguchi T, Takahashi M, Takahashi T. |
Title | Conditional Ror1 knockout reveals crucial involvement in lung adenocarcinomadevelopment and identifies novel HIF-1α regulator. |
Journal | Cancer Sci. |
Volume | 112 |
Page | 1614 |
Year | 2021 |
PMID | 33506575 |
Disease name, Applicable field | Metabolism, cancer, Immunology |