CARD ID | 787 | |
Type of strain | Transgenic. | |
Strain name | Tg(PrP delta preOR) | |
Internal Code | Tg(PrP delta preOR) | |
Submitter | YOSHIKAWA DAISUKE | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | ||
Origin (In-house) | Organization | Departmennto of Molecular Microbiology and Immunology |
Organization code | Ngs | |
Developer | Daisuke Yoshikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Prnp &Delta preOR |
Gene name | Prnp &Delta preOR |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
SHa-forward | gcgtgctggacaatgacgtg |
del-reverse | ggttggtttttggtttgctg |
Disease name, Applicable field | Unknown |