| CARD ID | 2402 | |
| Type of strain | Transgenic. | |
| Strain name | STOCK-Tg(Flk1-GFP) | |
| Internal Code | Flk1-GFP BAC Tg mouse | |
| Submitter | Ogasawara Kazumasa | |
| Submitter affiliation or code | Shiga University of Medical Science | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | ||
| Origin (In-house) | Organization | Shiga Univ. of Med. Sci. |
| Organization code | ||
| Developer | Masatsugu Ema | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Flk1 |
| Gene name | Flk1 |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| Flk1-B | CTGTGTCCCGCAGCCGGATA |
| GFP-AS | TGCCGTCGTCCTTGAAGAAGATG |
| Author | Ishitobi H., Matsumoto K., Azami T., Itoh F., Itoh S., Takahashi S., Ema M |
| Title | Flk1-GFP BAC Tg mice: an animal model for the study of blood vessel development. |
| Journal | Exp. Animals |
| Volume | 59 |
| Page | 615-622 |
| Year | 2010 |
| PMID |
| Author | Matsumoto K., Azami T., Otsu A., Takase H., Ishitobi H., Tanaka J., Miwa Y., Takahashi S., Ema M. |
| Title | Study of normal and pathological blood vessel morphogenesis in Flt1-tdsRed BAC Tg mice. |
| Journal | Genesis |
| Volume | 50 |
| Page | 561-571 |
| Year | 2012 |
| PMID |
| Disease name, Applicable field | Molecular biology, Development, Laboratory-animal Science, Immunology, cancer, Hematology |