CARD ID | 2246 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6-Tg(Pkd1l3-WGA)3Abek | |
Internal Code | PKD1L3-WGA | |
Submitter | Ishimaru Yoshiro | |
Submitter affiliation or code | Graduate School of Agricultural and Life Sciences, The University of Tokyo | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | ||
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | WGA |
Gene name | wheat germ agglutinin |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
1L3-F2 | acctctccctgcttgcaggtagc |
WGA-R1 | cgtaagggccatggtgctcatcatctttct |
Author | Yamamoto K, Ishimaru Y, Ohmoto M, Matsumoto I, Asakura T, Abe K. |
Title | Genetic tracing of the gustatory neural pathway originating from Pkd1l3-expressing type III taste cells in circumvallate and foliate papillae |
Journal | Journal of Neurochemistry |
Volume | 119 |
Page | 497-506 |
Year | 2011 |
PMID |
Disease name, Applicable field |