| CARD ID | 2342 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK-Rag2tm1,Jak3tm1,Mcm3aptm1Imku | |
| Internal Code | 1 | |
| Submitter | Kuwahara Kazuhiko | |
| Submitter affiliation or code | Aichi Cancer Center Research Institute | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Aichi Cancer Center Research Institute |
| Organization code | ||
| Developer | Kazuhiko Kuwahara | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Rag2 |
| Gene name | recombination activating gene 2 |
| Allele symbol | Rag2tm1 |
| Allele name | recombination activating gene 2, targeted mutation 1, |
| MGI | MGI:97849, |
| Chromosome | 2 (53.87) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Gene symbol | Jak3 |
| Gene name | Janus kinase 3 |
| Allele symbol | Jak3tm1 |
| Allele name | Janus kinase 3, targeted mutation 1, |
| MGI | MGI:99928, |
| Chromosome | 8 (34.43) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Gene symbol | Mcm3ap |
| Gene name | minichromosome maintenance complex component 3 associated protein |
| Allele symbol | Mcm3aptm1Ikmu |
| Allele name | minichromosome maintenance complex component 3 associated protein, targeted mutation 1,Department of Immunology, Kumamoto University Medical School |
| MGI | MGI:1930089, |
| Chromosome | 10 (38.88) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Neo 5'-int | GCAGCTGTGCTCGACGTTGT |
| Neo 3'-int | GGCGATACCGTAAAGCACGA |
| Disease name, Applicable field | Development, cancer |