CARD ID | 2679 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-B230118H07Riktm1 | |
Internal Code | C11orf74 KO 7bp del | |
Submitter | - - | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
No condition
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Dept cell Biol,Grad Sch of Med, Osaka Univ. |
Organization code | ||
Developer | Akihiro Harada | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | B230118H07Rik |
Gene name | RIKEN cDNA B230118H07 gene |
Allele symbol | B230118H07Riktm1 |
Allele name | RIKEN cDNA B230118H07 gene, targeted mutation 1, |
MGI | MGI:1915420, |
Chromosome | 2 (53.83) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
mC11ORF74-genome-FW | GGGTGCCCTTTGAGATTTTCC |
mC11ORF74-genome-RV | AAAGGCATAGGTGTCCATACC |
Disease name, Applicable field | Unknown |