| CARD ID | 553 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6.CB-Ahctf1tm1(EGFP) | |
| Internal Code | , B6.CB-Ahctf1tm1(EGFP) | |
| Submitter | Unknown Unknown | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kumamoto University |
| Organization code | ||
| Developer | Keisuke Okita | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ahctf1(old symbol:Elys) |
| Gene name | AT hook containing transciption factor 1 |
| Allele symbol | Ahctf1tm1(EGFP) |
| Allele name | targeted mutation 1 |
| MGI | |
| Chromosome | 1 (102) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM | OMIM ID: 610853 Human Gene Symbol: AHCTF1, |
| mYs321F | GGCAGTATGCAAGACTTGAC |
| EGFP SeqF | GAACTTGTGGCCGTTTACGT |
| Author | Keisuke Okita, Hiroshi Kiyonari, Ikuo Nobuhisa, Naoki Kimura, Shinichi Aizawa and Tetsuya Taga |
| Title | Targeted disruption of the mouse ELYS gene results in embryonic death at peri-implantation development |
| Journal | Genes to Cells |
| Volume | 9 |
| Page | 1083-1091 |
| Year | 2004 |
| PMID | 15507119 |
| Disease name, Applicable field | Development |