CARD R-BASE



Mouse strain


Strain information

CARD ID 2859
Type of strain Targeted mutant.
Strain name C57BL/6-Zfp541em2
Internal Code ZFP541-Line#49
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Zfp541
Gene name zinc finger protein 541
Allele symbol Zfp541em2
Allele name zinc finger protein 541; endonuclease-mediated mutation 2,
MGI MGI:3647699,
Chromosome 7 (8.74) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
ZFP541-F1 agctagctgccagcgagggctcttc
ZFP541-R2 tggttgagtgtgtcactgcagttgag
ZFP541-R3 gaggcagcagaagggaggtaggatg


Disease , Applicable field information

Disease name, Applicable field Cell biology, Reproduction






Copyright @ 2021 Kumamoto University. All rights reserved.