| CARD ID | 2131 | |
| Type of strain | Transgenic., Targeted mutant. | |
| Strain name | B6D2-Pmis2tm1Osb Tg(Clgn-Spot3Flag)25Osb | |
| Internal Code | Pmis2-Flag TG | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Pmis2 |
| Gene name | Pmis2, sperm specific protein |
| Allele symbol | Pmis2tmaOsb |
| Allele name | Pmis2, sperm specific protein; targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:1922177, |
| Chromosome | 7 (19.08) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Gene symbol | Spot3 |
| Gene name | Spot3 |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM |
| 196 | CCTTCCTgCggCTTgTTCTCT |
| 1793 | CGAATTCTCATAGGACTAGGACAAG |
| Author | Yamaguchi R, Fujihara Y, Ikawa M, Okabe M. |
| Title | Mice expressing aberrant sperm-specific protein PMIS2 produce normal-looking but fertilization-incompetent spermatozoa |
| Journal | Mol Biol Cell. |
| Volume | 23(14) |
| Page | 2671-9 |
| Year | 2012 |
| PMID |
| Disease name, Applicable field |