CARD ID | 2881 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Sycp2em1 | |
Internal Code | SYCP2-Line#17 | |
Submitter | Ishiguro Kei-ichiro | |
Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Sycp2 |
Gene name | synaptonemal complex protein 2 |
Allele symbol | Sycp2em1 |
Allele name | synaptonemal complex protein 2; endonuclease-mediated mutation 1, |
MGI | MGI:1933281, |
Chromosome | 2 (99.81) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
SYCP2-F1 | ATGTATACCTAGAAATGGAACTACATG |
SYCP2-R1 | CAAAGTATGAAGGTACTAACAATTAAAG |
SYCP2-R2 | ATACTTGGAGGTCTGGTCTCACTGGC |
Author | Fujiwara Y., Horisawa-Takada Y., Inoue E., Tani N., Shibuya H., Fujimura S., Kariyazono R., Sakata T., Ohta K., Araki K., Okada Y., Ishiguro K. |
Title | Meiotic cohesins mediate initial loading of HORMAD1 to the chromosomes and coordinate SC formation during meiotic prophase. |
Journal | PLOS Genetics |
Volume | |
Page | |
Year | 2020 |
PMID |
Disease name, Applicable field | Cell biology, Reproduction |