| CARD ID | 1888 | |
| Type of strain | Transgenic. | |
| Strain name | B6-Tg(Tyr-CRE/ERT2)Lru | |
| Internal Code | Tyr-CRE-ERT2 | |
| Submitter | Kato Masashi | |
| Submitter affiliation or code | Nagoya University Graduate School of Medicine Department of Occupational and Environmental Health | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Institut Curie |
| Organization code | Lru | |
| Developer | Lionel Larue | |
| Year introduced | 2007 / 9 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cre/ERT2 |
| Gene name | Cre recombinase, Estrogen receptor |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM | OMIM ID: 611458 Human Gene Symbol: GLB1, |
| pr0349 | GAAGCAACTCATCGATTG |
| pr0350 | TGAAGGGTCTGGTAGGATCA |
| Author | Yajima I, Belloir E, Bourgeois Y, Kumasaka M, Delmas V, Larue L. |
| Title | Spatiotemporal gene control by the Cre-ERT2 system in melanocytes. |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field | Molecular biology, Development, Laboratory-animal Science, Cell biology, cancer, Dermatology, Otorhinology, Ophthalomology |