CARD ID | 1851 | |
Type of strain | Targeted mutant. | |
Strain name | B6-Rpt3tm1 | |
Internal Code | floxed Rpt3 | |
Submitter | Takahashi Ryosuke | |
Submitter affiliation or code | Department of Neurology kyoto University Graduate School of Medicine | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Department of Neurology kyoto University Graduate School of Medicine |
Organization code | ||
Developer | Yoshitaka Tashiro , Ryousuke Takahashi | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Psmc4 |
Gene name | proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
Allele symbol | Psmc4tm1 |
Allele name | targeted mutation 1 |
MGI | |
Chromosome | 7 (16.11) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | MicroInjection |
OMIM |
floxed-Rpt3-F | TGAGCTGTGTATCAAGGTCC |
floxed-Rpt3-R | TAGAAGCTGCCTAAGGCACA |
Author | Tashiro Y, Urushitani M, Inoue H, Koike M, Uchiyama Y, Komatsu M, Tanaka K, Yamazaki M, Abe M, Misawa H, Sakimura K, Ito H, Takahashi R. |
Title | Motor Neuron-specific Disruption of Proteasomes, but not Autophagy, Replicates Amyotrophic Lateral Sclerosis. |
Journal | J Biol Chem. |
Volume | |
Page | PMID: 23095749 |
Year | 2012 |
PMID |
Disease name, Applicable field | Respiratory System, Aging, Behavior, Molecular biology, Development, Laboratory-animal Science, Cell biology, Genetics, Immunology, Obesity, Diabetes, infectious, cancer, Urology, peromelia, Dermatology, Neurobiology, Endocrine Disorders, Metabolism, Reproduction, Digestive Disorders, Hematology, Otorhinology, Dentistry, Osteosis, Ophthalomology |