| CARD ID | 2333 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;CB-Mcm3aptm1Imku | |
| Internal Code | ganp-floxed | |
| Submitter | Kuwahara Kazuhiko | |
| Submitter affiliation or code | Aichi Cancer Center Research Institute | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Aichi Cancer Center Research Institute |
| Organization code | ||
| Developer | Kazuhiko Kuwahara | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | mcm3ap |
| Gene name | minichromosome maintenance complex component 3 associated protein |
| Allele symbol | Mcm3aptm1Imku |
| Allele name | minichromosome maintenance complex component 3 associated protein; targeted mutation 1, Nobuo Sakaguchi |
| MGI | MGI:1930089, |
| Chromosome | 10 (38.88) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Neo2 | GCCTGCTTGCCGAATATCATGGTGGAAAAT |
| B/B3'-1 | ACCCCCAAGTCTCCCTTCTG |
| Author | Yoshimura T, Toyoda S, Kuramochi-Miyagawa S, Miyazaki T, Miyazaki S, Tashiro F, Yamato E, Nakano T, Miyazaki J |
| Title | Gtsf1/Cue110, a gene encoding a protein with two copies of a CHHC Zn-finger motif, is involved in spermatogenesis and retrotransposon suppression in murine testes |
| Journal | Developmental Biology |
| Volume | 335 |
| Page | 216-227 |
| Year | 2009 |
| PMID |
| Disease name, Applicable field | Immunology, cancer |