CARD ID | 1814 | |
Type of strain | Targeted mutant. | |
Strain name | B6;129-Mll1tm1uc | |
Internal Code | Mlluc | |
Submitter | Yokoyama Akihiko | |
Submitter affiliation or code | Kyoto University Graduate School of Medicine Medical Innovation Center Laboratory for Malignancy Control Research DSK project | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | Stanford University Medical School |
Organization code | Mlc | |
Developer | Michael L. Cleary | |
Year introduced | 2009 / 5 | |
Introduced Generation | ||
Remarks |
Gene symbol | Mll1 |
Gene name | myeloid/lymphoid or mixed-lineage leukemia 1 |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | 9 , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
dC&uc.fwd | gttctgaagcacacattccacacc |
dC&uc.rev | catcaaagcgaagggcaatcagtg |
Disease name, Applicable field | Molecular biology, cancer |