CARD ID | 1896 | |
Type of strain | Transgenic. | |
Strain name | B6;BALB-Tg(Krt19-Wnt1/K19-Ptgs2/K19-Ptges) | |
Internal Code | B6;BALB-Tg(Krt19-Wnt1/K19-Ptgs2/K19-Ptges), K19-Wnt1/C2mE(B6;BALB) | |
Submitter | Masanobu Oshima | |
Submitter affiliation or code | Division of Genetics, Cancer Research Institute, Kanazawa University | |
Stock Type | ||
Material Transfer Conditions |
Others
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Cancer Research Institute, Kanazawa Univ. |
Organization code | ||
Developer | Masanobu Oshima | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Wnt1, Ptgs2, Ptges |
Gene name | wingless-type MMTV integration site family, member 1; prostaglandin-endoperoxide synthase 2; prostaglandin E synthase |
Allele symbol | |
Allele name | |
MGI | MGI:98953, |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM | OMIM ID: 164820 Human Gene Symbol: WNT1, OMIM ID: 600262 Human Gene Symbol: PTGS2, OMIM ID: 605172 Human Gene Symbol: PTGES, |
Wnt1F,COX-2-F3 | CGACCGTGTTCTCTGAGATG,CAAACTCAAGTTTGACCCAG |
HA-R,COX-2-R1 | CATCATATGGGTAGGCCATGG,CTTTTACAGCTCAGTTGAACG |
Author | Oshima H and Oshima M |
Title | Mouse models of gastric tumors: Wnt activation and PGE2 induction. |
Journal | Pathology International |
Volume | 60 (9) |
Page | 599-607 |
Year | 2010 |
PMID |
Author | Oshima H, Oguma K, Du YC and Oshima M |
Title | Prostaglandin E2, Wnt, and BMP in gastric tumor mouse models. |
Journal | Cancer Science |
Volume | 100 (10) |
Page | 1779-1785 |
Year | 2009 |
PMID |
Author | Oshima H, Matsunaga A, Fujimura T, Tsukamoto T, Taketo MM, Oshima M. |
Title | Carcinogenesis in mouse stomach by simultaneous activation of the wnt signaling and prostaglandin e(2) pathway. |
Journal | Gastroenterology |
Volume | 131 |
Page | 1086-1095 |
Year | 2006 |
PMID |
Disease name, Applicable field | cancer |