CARD R-BASE



Mouse strain


Strain information

CARD ID 3261
Type of strain Targeted mutant.
Strain name C57BL/6-Hlfem1
Internal Code Hlf-tdTomato
Submitter Tomomasa Yokomizo
Submitter affiliation or code Tokyo Women’s Medical University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Hlf
Gene name hepatic leukemia factor
Allele symbol Hlfem1
Allele name hepatic leukemia factor; endonuclease-mediated mutation 1,
MGI MGI:96108,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
NW180 caggaggtggctgatttaag
NW197 tagttgccagccatctgttg
NW333 tcccattctgagatacaccagtg


References

Author Yokomizo T, Watanabe N, Umemoto T, Matsuo J, Harai R, Kihara Y, Nakamura E, Tada N, Sato T, Takaku T, Shimono A, Takizawa H, Nakagata N, Mori S, Kurokawa M, Tenen DG, Osato M, Suda T, Komatsu N
Title Hlf marks the developmental pathway for hematopoietic stem cells but not for erythro-myeloid progenitors
Journal J Exp Med
Volume 216(7)
Page 1599-1614
Year 2019
PMID 31076455


Disease , Applicable field information

Disease name, Applicable field cancer, infectious, Immunology, Cell biology, Laboratory-animal Science, Development






Copyright @ 2021 Kumamoto University. All rights reserved.