| CARD ID | 3250 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Ftsj1tm1 | |
| Internal Code | Ftsj1-f | |
| Submitter | Kazuhito Tomizawa | |
| Submitter affiliation or code | Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ftsj1 |
| Gene name | FtsJ RNA 2'-O-methyltransferase 1 |
| Allele symbol | Ftsj1tm1 |
| Allele name | FtsJ RNA 2'-O-methyltransferase 1; targeted mutation 1, |
| MGI | MGI:1859648, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Ftsj1_Flox_forward | TTCTTTTGGTCCCCATGGGC |
| Ftsj1_Flox_reverse | CAACCCTCAGGCTTTCTCCA |
| Author | Nagayoshi, Y.§, Chujo, T.§, Hirata, S., Nakatsuka, H., Chen, C.W., Takakura, M., Miyauchi, K., Ikeuchi, Y., Carlyle, B.C., Kitchen, R.R., Suzuki, T., Katsuoka, F., Yamamoto, M., Goto, Y., Tanaka, M., Natsume K., Nairn A.C., Suzuki, T., Tomizawa, K.* & Wei, F.Y.* |
| Title | Loss of Ftsj1 perturbs codon-specific translation in the brain and is associated with X-linked intellectual disability. |
| Journal | Science Advances |
| Volume | |
| Page | |
| Year | 2021 |
| PMID | 33771871 |
| Disease name, Applicable field |