CARD ID | 2780 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Nfatc1tm1 6b | |
Internal Code | Nfatc1 variant 3 exon1-specific knockout mice6b | |
Submitter | Mimura Toshihide | |
Submitter affiliation or code | Department of Rheumatology and Applied Immunology,Faculty of Medicine, Saitama Medical University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | 2015 / 7 | |
Introduced Generation | ||
Remarks |
Gene symbol | Nfatc1 |
Gene name | Nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1 |
Allele symbol | Nfatc1tm1 |
Allele name | Nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1, targeted mutation 1, |
MGI | MGI:102469, |
Chromosome | 18 (53.66) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | MicroInjection |
OMIM |
target_S | TCCAGTCCCTTCCAAGTTTCCACTC |
target_R | TCTGGGCTGCGCCGGGGAAACAC |
Disease name, Applicable field | Immunology, Osteosis |