CARD ID | 1937 | |
Type of strain | Gene trap. | |
Strain name | MSM/Ms-45SrRNAintGt(pU-21MT)14Card | |
Internal Code | Ayu21-MT14 | |
Submitter | Araki Kimi | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | IRDA, Kumamoto University |
Organization code | Card | |
Developer | Kimi Araki | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | 45SrRNAint |
Gene name | 45S rRNA gene intergenic spacer |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | Unknown , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Z-1 | GCGTTACCCAACTTAATCG |
Z-2 | TGTGAGCGAGTAACAACCCG |
Author | Mai Nakahara, et al. |
Title | Gene-trap mutagenesis using Mol/MSM-1 embryonic stem cells from MSM/Ms mice. |
Journal | Mamm. Genome |
Volume | 24 (5-6) |
Page | 228-239 |
Year | 2013 |
PMID |
Disease name, Applicable field | Development |
EGTC番号 | 21-MT14 |