| CARD ID | 2578 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6J-Del(3 H2-H4)91S | |
| Internal Code | C57BL/6J-Ch3H2-491Stm1Ati | |
| Submitter | Irie Atsushi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Graduate School of Medical Sciences,Kumamoto Univ. |
| Organization code | ||
| Developer | Atsushi Irie | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | - |
| Gene name | - |
| Allele symbol | |
| Allele name | |
| MGI | MGI:, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Gene symbol | - |
| Gene name | - |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Gene symbol | - |
| Gene name | - |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| 7056-7082F | GTCTATGGGATGGGATTTGAGTTGGGC |
| 3501-3481R | GCATAATATGGTCTGAGAAGC |
| Disease name, Applicable field |