CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2972
Type of strain Targeted mutant.
Strain name C57BL/6-Fbxo47em1(Fbxo47-3xFLAG-HA)
Internal Code Fbxo47-3FH
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Fbxo47
Gene name F-box protein 47
Allele symbol Fbxo47em1(Fbxo47-3xFLAG-HA)
Allele name
MGI MGI:1920223,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Fbxo47-F4 TCTGTTCCATCTTCTCCATGCTCAGGC
Fbxo47-R3 TGAAGAGCCAGAACTTGTTTTCCAG


Disease , Applicable field information

Disease name, Applicable field Reproduction, Cell biology


EGTC

EGTC番号




Copyright @ 2021 Kumamoto University. All rights reserved.