CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2631
Type of strain Targeted mutant.
Strain name C57BL/6- Ffar2 tm1
Internal Code Gpr43-Flox
Submitter Kimura Ikuo
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Department of Applied Biological Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology
Organization code
Developer Ikuo Kimura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Ffar2
Gene name Free fatty acid receptor 2
Allele symbol Ffar2 tm1
Allele name Free fatty acid receptor 2, targeted mutation 1
MGI MGI:2441731,
Chromosome 7 (19.25) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Gpr43floxF CAATCCTGCCTCCTCTATGC
Gpr43floxR CTTGCGGGGAAATGAGTTAG


Disease , Applicable field information

Disease name, Applicable field Unknown






Copyright @ 2021 Kumamoto University. All rights reserved.