CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2479
Type of strain Transgenic.
Strain name B6D2-Tg(CAG-flpo)1Osb
Internal Code CAG-FLPo#1
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Others
Production method
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol FLPo
Gene name FLPo
Allele symbol Tg(CAG-FLPo)1Osb
Allele name transgene insertion 1, Research Institute for Microbial Diseases, Osaka University
MGI
Chromosome
Gene classification Gene to express(transgenic)
Method
OMIM

PCR Primer 1
750 GCAACGTGCTGGTTGTTGTGCTGTCTCATC
5867 TCAGATCCGCCTGTTGATGTAGCTG


References

Author Yamazaki D, Miyata H, Funato Y, Fujihara Y, Ikawa M, Miki H.
Title The Mg2+ transporter CNNM4 regulates sperm Ca2+ homeostasis and is essential for reproduction.
Journal J Cell Sci.
Volume 129(9)
Page 1940-9
Year 2016
PMID


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.