CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2403
Type of strain Transgenic.
Strain name STOCK-Tg(Flt1-tdsRed)
Internal Code Flt1-tdsRed BAC Tg mouse
Submitter Ogasawara Kazumasa
Submitter affiliation or code Shiga University of Medical Science
Stock Type
Material Transfer Conditions Consent to us
Production method
Origin (In-house) Organization Shiga Univ. of Med. Sci.
Organization code
Developer Masatsugu Ema
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Flt1
Gene name Flt1
Allele symbol
Allele name
MGI
Chromosome
Gene classification Gene to express(transgenic)
Method MicroInjection
OMIM

PCR Primer 1
mFlt1 WT geno 5-2 GCTGCAGGCGCGGAGAAGGGCTCTC
tdsRed AS1 GCTTCACGTACACCTTGGAGC


References

Author Matsumoto K., Azami T., Otsu A., Takase H., Ishitobi H., Tanaka J., Miwa Y., Takahashi S., Ema M.
Title Study of normal and pathological blood vessel morphogenesis in Flt1-tdsRed BAC Tg mice.
Journal Genesis
Volume 50
Page 561-571
Year 2012
PMID


Disease , Applicable field information

Disease name, Applicable field Development, Laboratory-animal Science, Immunology, cancer, Hematology






Copyright @ 2021 Kumamoto University. All rights reserved.