Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank

Mouse strain

Strain information

CARD ID 2064
Type of strain Gene trap.
Strain name B6.Cg-Fblim1Gt(Ayu21-T327*mERT2)3Card
Internal Code Fblim1-mERT2,1280
Submitter Masatake ARAKI
Submitter affiliation or code Gene Technology Center, Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization IRDA, Kumamoto University
Organization code Card
Developer Masatake Araki
Origin (From other organizations) Organization
Organization code
Year introduced
Introduced Generation

Gene information

Gene symbol Fblim1
Gene name filamin binding LIM protein 1
Allele symbol
Allele name
MGI MGI:1921452,
Chromosome 4 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation

PCR Primer 1
Cre-1 acatgttcagggatcgccag
Cre-2 taaccagtgaaacagcattgc

Disease , Applicable field information

Disease name, Applicable field Others

Copyright @ 2021 Kumamoto University. All rights reserved.