CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1946
Type of strain Gene trap.
Strain name MSM/Ms-FtoGt(pU-21MT)48Card
Internal Code Ayu21-MT48
Submitter Araki Kimi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization IRDA, Kumamoto University
Organization code Card
Developer Kimi Araki
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Fto
Gene name fat mass and obesity associated
Allele symbol
Allele name
MGI MGI:1347093,
Chromosome 8 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Z-1 GCGTTACCCAACTTAATCG
Z-2 TGTGAGCGAGTAACAACCCG


References

Author Mai Nakahara, et al.
Title Gene-trap mutagenesis using Mol/MSM-1 embryonic stem cells from MSM/Ms mice.
Journal Mamm. Genome
Volume 24 (5-6)
Page 228-239
Year 2013
PMID


Disease , Applicable field information

Disease name, Applicable field Development


EGTC

EGTC番号 21-MT48




Copyright @ 2021 Kumamoto University. All rights reserved.