CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1748
Type of strain Gene trap.
Strain name B6; CB-Fzr1/Cdh1GT(Cdh1 KI)
Internal Code Fzrcdh1(GT(ResP17))
Submitter Saya Hideyuki
Submitter affiliation or code Division of Gene Regulation, Institute for Advanced Medical Research,Keio University School of Medicine
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Fzr1
Gene name fizzy/cell division cycle 20 related 1 (Drosophila)
Allele symbol
Allele name
MGI MGI:1926790,
Chromosome 10 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
FzrORF-s atggaccaggactatgagcg
FzrORF-as ctatcggatccgggtgaagag


References

Author Naoe H, Araki K, Nagano O, Kobayashi Y, Ishizawa J, Chiyoda T, Shimizu T, Sasaki Y, Yamamura KI, Saya H, Kuninaka S
Title The anaphase-promoting complex/cyclosome activator Cdh1 modulates RhoGTPase by targeting p190 RhoGAP for degradation.
Journal Mol. Cell. Biol.
Volume 30
Page 3994-4005
Year 2010
PMID


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.