| CARD ID | 1228 | |
| Type of strain | Transgenic. | |
| Strain name | B6N;B6J-Tg(AP2-Angptl2)5-23 | |
| Internal Code | aP2-Angptl2 Line5-23 | |
| Submitter | Oike Yuich | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Angptl2 |
| Gene name | angiopoietin-like2 |
| Allele symbol | Tg(AP2-Angptl2)5-23 |
| Allele name | transgene insertion 5-23 |
| MGI | MGI:1347002, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| Primer-1 | acttctacatgagatcattc |
| Primer-2 | ggtattctcaggcttcaccaggta |
| Disease name, Applicable field |