CARD R-BASE



Mouse strain


Strain information

CARD ID 2153
Type of strain Targeted mutant.
Strain name STOCK Spaca3tm1Osb/M6F
Internal Code Spaca3 KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Spaca3
Gene name sperm acrosome associated 3
Allele symbol Spaca3tm1Osb
Allele name sperm acrosome associated 3, targeted mutatiom 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:1922872,
Chromosome 11 (48.40) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
#719 GCCTTCTATCGCCTTCTTGACGAGTTCTTC
#5948 GCCACCCCACAGTTCAGCC
PCR Primer 2
#5949 GCTCCTGAAACTGCCACTCGTTTG


References

Author Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM.
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice.
Journal Proc Natl Acad Sci U S A.
Volume 113(28)
Page 7704-10
Year 2016
PMID 27357688


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.