CARD ID | 2489 | |
Type of strain | Transgenic. | |
Strain name | B6D2-Tg(Stra8-Cre)1Osb | |
Internal Code | Stra8-cre | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Others
|
|
Production method | ||
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Cre |
Gene name | Cre |
Allele symbol | Tg(Stra8-Cre)1Osb |
Allele name | transgene insertion 1, Research Institute for Microbial Diseases, Osaka University |
MGI | |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | |
OMIM |
259 | TTCCAGGGCGCGAGTTGATAG |
5224 | CTCCAAGGGGGTAAGGTGTAGC |
Author | Tokuhiro K1, Satouh Y1, Nozawa K1,2, Isotani A1,3,4, Fujihara Y1, Hirashima Y5, Matsumura H1,4, Takumi K1,4, Miyano T5, Okabe M1, Benham AM1,6, Ikawa M1,2,3,4. |
Title | Calreticulin is required for development of the cumulus oocyte complex and female fertility. |
Journal | Sci Rep. |
Volume | 5 |
Page | 14254 |
Year | 2015 |
PMID |
Disease name, Applicable field |