CARD R-BASE



Mouse strain


Strain information

CARD ID 2357
Type of strain Targeted mutant.
Strain name C57BL/6-C2cd4ctm1(LacZ)
Internal Code C2cd4c deficient mice(Neo minus)
Submitter Kume Shoen
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Tokyo Institute of Technology
Organization code
Developer Shoen Kume
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol C2cd4c
Gene name C2 calcium-dependent domain containing 4C
Allele symbol C2cd4ctm1(LacZ)
Allele name C2 calcium-dependent domain containing 4C, targeted mutation 1,
MGI MGI:2685084,
Chromosome 10 (39.72) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
C2cd4c forward gtgctcagcgtgatcctaca
C2cd4c reverse ccgaagtcgttccaagaacc
C2cd4c null ccacaacgggttcttctgtt


Disease , Applicable field information

Disease name, Applicable field Molecular biology, Development, Obesity, Diabetes, Neurobiology, Endocrine Disorders, Metabolism, Reproduction, Digestive Disorders, Ophthalomology






Copyright @ 2021 Kumamoto University. All rights reserved.