| CARD ID | 2988 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6N-Fbxl20tm1 | |
| Internal Code | Scrapper-flox mouse | |
| Submitter | Yao Ikuko | |
| Submitter affiliation or code | Kwansei Gakuin University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kwansei Gakuin Univ. |
| Organization code | ||
| Developer | Ikuko Yao | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Fbxl20 |
| Gene name | F-box and leucine-rich repeat protein 20 |
| Allele symbol | Fbxl20tm1 |
| Allele name | F-box and leucine-rich repeat protein 20; targeted mutation 1, |
| MGI | MGI:1919444, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Scrapper-loxF1 | GACGGTTGACATGGTGACAG |
| Scrapper-loxR1 | GTTCTCAAATACAGCGGTGG |
| Disease name, Applicable field | Metabolism, Neurobiology |