| CARD ID | 2613 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6.129S2-Mir200btm1.1Osb Mir429T30C | |
| Internal Code | miR-DKO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mir429 |
| Gene name | microRNA 429 |
| Allele symbol | Mir429T31C |
| Allele name | |
| MGI | MGI:3619402, |
| Chromosome | 4 (87.95) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Gene symbol | Mir200b |
| Gene name | microRNA 200b |
| Allele symbol | Mir200btm1.1Osb |
| Allele name | microRNA 200b, targeted mutation 1.1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:2676875, |
| Chromosome | 4 (87.96) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| pr-3 | GCACTTGACTGTCCTAATTCCCAGGGC |
| pr-4 | GCCCATGGAATCTAGTCATCTTCAACTCCC |
| Author | Hasuwa H, Ueda J, Ikawa M, Okabe M. |
| Title | miR-200b and miR-429 function in mouse ovulation and are essential for female fertility. |
| Journal | Science |
| Volume | 341(6141) |
| Page | 71-3 |
| Year | 2013 |
| PMID |
| Disease name, Applicable field |