CARD ID | 2150 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK Plac1tm1(KOMP)Osb/2 | |
Internal Code | Plac1 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Plac1 |
Gene name | placental specific protein 1 |
Allele symbol | Plac1tm1(KOMP)Osb |
Allele name | placental specific protein 1, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University |
MGI | MGI:1926287, |
Chromosome | X (29.31) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
#5319 | ATCCGGGGGTACCGCGTCGAG |
#5706 | GTTCACTCAGATGATCTGAGGAAACCC |
#5707 | ACCCAGGCACCAATGCTAGC |
Author | Muto M, Fujihara Y, Tobita T, Kiyozumi D, Ikawa M. |
Title | Lentiviral Vector-Mediated Complementation Restored Fetal Viability but Not Placental Hyperplasia in Plac1-Deficient Mice. |
Journal | Biol Reprod |
Volume | 94 (1) |
Page | 6 |
Year | 2016 |
PMID |
Disease name, Applicable field |